| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rG Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Mn2+ |
RNA phosphodiester | N 80 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.0, 400 mM NaCl, 100 mM KCl, 7.5 mM MnCl2, 50 µM CuCl2, 7.5 mM MgCl2 |
| Catalytic region of the DNAzyme |
|---|
| ACTGCCAGCGGCGCGATTCACTGTCGGAGACTAGTTGTTGCCTTCGGCTTGGAAGGACAAAACTTTTGTCATAGCGTGGG |
| Notes |
|---|
| Appears to contain a variant of the 8-17 motif close to the 5′ end. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2004 | K Schlosser | Y Li | Tracing sequence diversity change of RNA-cleaving deoxyribozymes under increasing selection pressure during in vitro selection. | 15274624 | 10.1021/bi049757j | RNA cleavage |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2006 | K Schlosser | Y Li | Characterization of long RNA-cleaving deoxyribozymes with short catalytic cores: the effect of excess sequence elements on the outcome of in vitro selection. | 16682452 | 10.1093/nar/gkl276 |
RNA cleavage |
| 1997 | S W Santoro | G F Joyce | A general purpose RNA-cleaving DNA enzyme. | 9113977 | 10.1073/pnas.94.9.4262 |
RNA cleavage |