| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rG Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
metal ion dependency not reported |
RNA phosphodiester* | N 50 |
|---|
| Buffer conditions |
|---|
| 10 mM MgCl2, 0.5 M NaCl, 50 mM EPPS pH 7.5 |
| Catalytic region of the DNAzyme |
|---|
| GGGACCGGCCACTCGGAGGCATCCATCGTTGCAGACCTTCTTCCCCCTGC |
| Notes |
|---|
| Cleaves a 2′,5′-linked beta-D-ribonucleotide. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2002 | P Ordoukhanian | G F Joyce | RNA-cleaving DNA enzymes with altered regio- or enantioselectivity. | 12381192 | 10.1021/ja027467p | RNA cleavage |