| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of L-rG Group 2 - vicinal phosphate |
X: LrG S: ACTCTTCTTAGCTXTGGTTCGATCAAGA |
specific cleavage at desired position |
Mn2+ Co2+ Cd2+ |
RNA phosphodiester | N * |
|---|
| Buffer conditions |
|---|
| 60 mM HEPES pH 7.5, 300 mM NaCl, 100 mM KCl, 15 mM MgCl2, 15 mM MnCl2 |
| kcat/ kobs |
|---|
| kcat = 2.6 min-1 |
| Catalytic region of the DNAzyme |
|---|
| TGATCGAACTCAACCCGCGTAAGCTCTACAGGAACGGGCAATACGGAAGAGT |
| Notes |
|---|
| Trans-cleaving version designed based on LRD-B. The RNA substrate contains a single guanosine L-ribonucleotide (LrG) as the cleavage site. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2015 | K Tram | Y Li | An Efficient Catalytic DNA that Cleaves L-RNA. | 25946137 | 10.1371/journal.pone.0126402 | RNA cleavage |