DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of L-rG

Group 2 - vicinal phosphate

X: LrG
S: ACTCTTCTTAGCTXTGGTTCGATCAAGA
specific cleavage at desired position Mn2+
Co2+
Cd2+
RNA phosphodiester N *
 Buffer conditions
60 mM HEPES pH 7.5, 300 mM NaCl, 100 mM KCl, 15 mM MgCl2, 15 mM MnCl2
 kcat/ kobs
kcat = 2.6 min-1
 Catalytic region of the DNAzyme
TGATCGAACTCAACCCGCGTAAGCTCTACAGGAACGGGCAATACGGAAGAGT
Notes
Trans-cleaving version designed based on LRD-B. The RNA substrate contains a single guanosine L-ribonucleotide (LrG) as the cleavage site.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2015 K Tram Y Li An Efficient Catalytic DNA that Cleaves L-RNA. 25946137 10.1371/journal.pone.0126402 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra