| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of L-rG Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
metal ion dependency not reported |
RNA phosphodiester | N 60 |
|---|
| Buffer conditions |
|---|
| 60 mM HEPES pH 7.5, 300 mM NaCl, 100 mM KCl, 15 mM MgCl2, 15 mM MnCl2 |
| kcat/ kobs |
|---|
| k = 0.34 min-1 |
| Catalytic region of the DNAzyme |
|---|
| AACCCGCGTAAGCTCTACAGGAACGGGCAATACGGAAAAAAGATATGCTAAAGGCAGCCG |
| Notes |
|---|
| The RNA substrate contains a single guanosine L-ribonucleotide (LrG) as the cleavage site. Clone chosen for further studies. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2015 | K Tram | Y Li | An Efficient Catalytic DNA that Cleaves L-RNA. | 25946137 | 10.1371/journal.pone.0126402 | RNA cleavage |