| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. S: cleavage in cis |
specific cleavage at desired position |
metal ion dependency not reported |
RNA phosphodiester | N 56 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 6.8, 400 mM NaCl, 100 mM KCl, 7.5 mM MgCl2, 5 mM MnCl2, 1.25 mM CdCl2, 1 mM CoCl2, 0.25 mM NiCl2 |
| Catalytic region of the DNAzyme |
|---|
| TCGAGGTACCAATTATTGTGAATAATGATGGCGATAGCCAGTCGGTACAGAGTTTTGTAC |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2006 | W Chiuman | Y Li | Evolution of high-branching deoxyribozymes from a catalytic DNA with a three-way junction. | 17052610 | 10.1016/j.chembiol.2006.08.009 | RNA cleavage |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2006 | W Chiuman | Y Li | Revitalization of six abandoned catalytic DNA species reveals a common three-way junction framework and diverse catalytic cores. | 16480741 | 10.1016/j.jmb.2006.01.036 |
RNA cleavage |