DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine.
S: cleavage in cis
specific cleavage at desired position metal ion dependency not reported
RNA phosphodiester N 56
 Buffer conditions
50 mM HEPES pH 6.8, 400 mM NaCl, 100 mM KCl, 7.5 mM MgCl2, 5 mM MnCl2, 1.25 mM CdCl2, 1 mM CoCl2, 0.25 mM NiCl2
 Catalytic region of the DNAzyme
TCGAGGAACCAAATATTGTGAATATTGATGCCTGGCGGCAGTCGGTACCGAGGTCGGTAC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2006 W Chiuman Y Li Evolution of high-branching deoxyribozymes from a catalytic DNA with a three-way junction. 17052610 10.1016/j.chembiol.2006.08.009 RNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2006 W Chiuman Y Li Revitalization of six abandoned catalytic DNA species reveals a common three-way junction framework and diverse catalytic cores. 16480741 10.1016/j.jmb.2006.01.036 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra