DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine.
S: cleavage in cis
specific cleavage at desired position Mn2+
Co2+
RNA phosphodiester N *
 Buffer conditions
50 mM Hepes pH 6.8, 0.4 M NaCl, 100 mM KCl, 7.5 mM MgCl2, 5 mM MnCl2, 1.25 mM CdCl2, 1 mM CoCl2, 0.25 mM NiCl2, 0.002% (v/v) Tween-20
 Yield (%) kcat/ kobs
66 kobs = 0.24 min-1
 Catalytic region of the DNAzyme
AGAAGTGCACTTTGATTAAGTGCAGCCTGGTGAATAGTTCGCATGGAGTTCGGTAA
Notes
Sequences have been annotated for the catalytic region. The cis-cleaving DNAzymes can be engineered easily into a trans-cleaving system. Evolved from "once abandoned" (OA) sequences from previous in vitro selection experiments.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2006 W Chiuman Y Li Revitalization of six abandoned catalytic DNA species reveals a common three-way junction framework and diverse catalytic cores. 16480741 10.1016/j.jmb.2006.01.036 RNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2006 W Chiuman Y Li Evolution of high-branching deoxyribozymes from a catalytic DNA with a three-way junction. 17052610 10.1016/j.chembiol.2006.08.009 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra