Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis* |
specific cleavage at desired position |
Mg2+-independent |
RNA phosphodiester | N 40 |
---|
kcat/ kobs |
---|
kobs = 0.015 h-1 |
Catalytic region of the DNAzyme |
---|
ACATCATGCGAGCACACGCAATAGCCTGATAAGGTTGGTAG |
Notes |
---|
The initial library was based on the sequence used by Breaker and Joyce (Breaker, R. R., and Joyce, G. F. (1995) A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity, Chem. Biol. 2, 655-660) with an internal riboadenosine incorporated at position 28 to provide a cleavable linker. 614 catalyzes the cleavage of the ribo-adenosine embedded within the cat + ribose primer, either as a part of its own sequence or in trans. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2004 | M A Carrigan | S A Benner | Quantitative analysis of a RNA-cleaving DNA catalyst obtained via in vitro selection. | 15350131 | 10.1021/bi049898l | RNA cleavage |