DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine.
S: cleavage in cis
specific cleavage at desired position metal ion dependency not reported
RNA phosphodiester N 60
 Buffer conditions
10 mM Mg2+, pH 7.5
 Catalytic region of the DNAzyme
TCAACTGGACTATCTGGGGCAATCAGAGAATCGTAGGGTCTGAGGTTCGGTGGGTAGCATGGA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2007 W Chiuman Y Li Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design. 18030352 10.1371/journal.pone.0001224 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra