| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. S: cleavage in cis |
specific cleavage at desired position |
metal ion dependency not reported |
RNA phosphodiester | N 60 |
|---|
| Buffer conditions |
|---|
| 10 mM Mg2+, pH 7.5 |
| Catalytic region of the DNAzyme |
|---|
| TCAACTGAGCTATCTGGGGCAATCAGAGAAATTGTAGGGTTTGAGGTTCGGTGGGTAGCACGGA |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2007 | W Chiuman | Y Li | Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design. | 18030352 | 10.1371/journal.pone.0001224 | RNA cleavage |