| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. S: ACTCTTCCTAGCFrAQGGTTCGATCAAGA |
specific cleavage at desired position |
Mg2+ |
RNA phosphodiester | N 60 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 8.0, 40 mM MgCl2, 0.001% Tween-20 |
| Yield (%) | kcat/ kobs |
|---|---|
| 91 | kc = 1 min-1 |
| Catalytic region of the DNAzyme |
|---|
| GAACCAGGTCGGGGCCGAAATATAGGATATTTTGGGAGGCTATGCTAGG |
| Notes |
|---|
| Resulting from the reselection of MgZ-5. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2007 | W Chiuman | Y Li | Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design. | 18030352 | 10.1371/journal.pone.0001224 | RNA cleavage |