Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA* Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Zn2+ |
RNA phosphodiester | N 50 |
---|
Buffer conditions |
---|
25 mM NaCl, 50 mM MOPS pH 7.5, Zn2+ |
Catalytic region of the DNAzyme |
---|
CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGGTGGAAGATCATCAGTATTTCATTAGGTTGGAGCAAGAGCGGTTCCAGTTAGTGACGGTAAGCTTGGCAC |
Notes |
---|
The cleavage junction is modified with a glycyl-histidine functionalized tertiary amine moiety. Sequences annotated directly after selection, this means that the sequences contain the catalytic region and also the constant regions (including the substrate). |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2020 | P-J J Huang | J Liu | Target Self-Enhanced Selectivity in Metal-Specific DNAzymes. | 31867832 | 10.1002/anie.201915675 | RNA cleavage |