| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA* Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Zn2+ |
RNA phosphodiester | N 50 |
|---|
| Buffer conditions |
|---|
| 25 mM NaCl, 50 mM MOPS pH 7.5, Zn2+ |
| kcat/ kobs |
|---|
| kobs = 0.040 min-1 |
| Catalytic region of the DNAzyme |
|---|
| GATGAGAGGACCAATCACACAAATATGTGAGGTGCTGGACTCCAGCGGGA |
| Notes |
|---|
| The cleavage junction is modified with a glycyl-histidine functionalized tertiary amine moiety. Only the sequence of the catalytic region is annotated. Engineered to act in trans. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2020 | P-J J Huang | J Liu | Target Self-Enhanced Selectivity in Metal-Specific DNAzymes. | 31867832 | 10.1002/anie.201915675 | RNA cleavage |