DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA*

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Zn2+
RNA phosphodiester N 50
 Buffer conditions
25 mM NaCl, 50 mM MOPS pH 7.5, Zn2+
 kcat/ kobs
kobs = 0.0033 min-1
 Catalytic region of the DNAzyme
TGTCTCTGACCTCTAGAGTGGAGCAAATCGTAAGGATCCAGTGGACGAAA
Notes
The cleavage junction is modified with a glycyl-histidine functionalized tertiary amine moiety. Only the sequence of the catalytic region is annotated. Engineered to act in trans.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2020 P-J J Huang J Liu Target Self-Enhanced Selectivity in Metal-Specific DNAzymes. 31867832 10.1002/anie.201915675 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra