DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH

Group 2 - vicinal phosphate

S: cleavage in cis
M2+-independent
RNA phosphodiester N 40
 Buffer conditions
50 mM sodium cacodylate pH 7.5, 200 mM NaCl, 1 mM EDTA
 Catalytic region of the DNAzyme
AAGCAGCGGATGTGGTGTGACGCGGAGTCCCGGGTAGGGCTT
Notes
Reselected from 7-45.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2018 Y Wang D M Perrin A densely modified M2+-independent DNAzyme that cleaves RNA efficiently with multiple catalytic turnover None 10.1039/C7SC04491G RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra