Reaction | Reacting groups | Substrates | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH Group 2 - vicinal phosphate |
S: cleavage in cis |
M2+-independent |
RNA phosphodiester | N 40 |
Buffer conditions |
---|
50 mM sodium cacodylate pH 7.5, 200 mM NaCl, 1 mM EDTA |
Catalytic region of the DNAzyme |
---|
TTACAGTGGTAGCGGTTGGCATGTGTGGAGCGTAAGTGAGCG |
Notes |
---|
DNAzymes are selected using 8-histaminyl-deoxyadenosine (dA<sup>im</sup>TP), 5-guanidinoallyl-deoxyuridine (dU<sup>ga</sup>TP), and 5-aminoallyl-deoxycytidine (dC<sup>aa</sup>TP) along with dGTP. The 17 nt all-RNA substrate is taken from the HIV-LTR untranslated message; the potential cleavage was directed at either of the four unpaired RNA linkages opposite the initial random region. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2018 | Y Wang | D M Perrin | A densely modified M2+-independent DNAzyme that cleaves RNA efficiently with multiple catalytic turnover | None | 10.1039/C7SC04491G | RNA cleavage |