DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH

Group 2 - vicinal phosphate

S: cleavage in cis
M2+-independent
RNA phosphodiester N 40
 Buffer conditions
50 mM sodium cacodylate pH 7.5, 200 mM NaCl, 1 mM EDTA
 Catalytic region of the DNAzyme
TTACAGTGGTAGCGGTTGGCATGTGTGCAGCGTAGGTGGGCG
Notes
DNAzymes are selected using 8-histaminyl-deoxyadenosine (dA<sup>im</sup>TP), 5-guanidinoallyl-deoxyuridine (dU<sup>ga</sup>TP), and 5-aminoallyl-deoxycytidine (dC<sup>aa</sup>TP) along with dGTP. The 17 nt all-RNA substrate is taken from the HIV-LTR untranslated message; the potential cleavage was directed at either of the four unpaired RNA linkages opposite the initial random region.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2018 Y Wang D M Perrin A densely modified M2+-independent DNAzyme that cleaves RNA efficiently with multiple catalytic turnover None 10.1039/C7SC04491G RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra