DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rG

Group 2 - vicinal phosphate

S: GGCGUGCCCGUCUGUUGGC
* M2+-independent
RNA phosphodiester N 40
 Buffer conditions
50 mM cacodylate pH 7.45, 200 mM NaCl, 1 mM EDTA
 kcat/ kobs
kcat = 1.06 min-1
 Catalytic region of the DNAzyme
TTACAGTGGTATCGATTGGGACGTGTGGAGCGTCAGGATGGTACA
Notes
Reselected from 7-38. Engineered to act in trans. Cleavage site G10.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2018 Y Wang D M Perrin A densely modified M2+-independent DNAzyme that cleaves RNA efficiently with multiple catalytic turnover None 10.1039/C7SC04491G RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra