DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rG

Group 2 - vicinal phosphate

S: cleavage in cis
* Zn2+
RNA phosphodiester N 50
 Buffer conditions
10 µM Zn2+, 2 mM MgCl2, 150 mM NaCl, 50 mM EPPS pH 7.5
 Catalytic region of the DNAzyme
GACAGCAATATCTTCGTTGACCCCTTGCTCTATATAGCCTTCAGGCCCCC
Notes
The nucleic acid libraries used for selection contained C5-imidazole-functionalized deoxyuridine in place of thymidine. T corresponds to a position occupied by imidazole-dU in the annotated sequence.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2000 S W Santoro C F Barbas RNA Cleavage by a DNA Enzyme with Extended Chemical Functionality None 10.1021/ja993688s RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra