| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rG Group 2 - vicinal phosphate |
S: cleavage in cis |
* |
Zn2+ |
RNA phosphodiester | N 50 |
|---|
| Buffer conditions |
|---|
| 10 µM Zn2+, 2 mM MgCl2, 150 mM NaCl, 50 mM EPPS pH 7.5 |
| kcat/ kobs |
|---|
| kcat >1 min-1 |
| Catalytic region of the DNAzyme |
|---|
| CCCAGAAGGCCGAAACCGCTTCGTTGACCCCTTGCTCTAGGGTTACTAGG |
| Notes |
|---|
| The nucleic acid libraries used for selection contained C5-imidazole-functionalized deoxyuridine in place of thymidine. T corresponds to a position occupied by imidazole-dU in the annotated sequence. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2000 | S W Santoro | C F Barbas | RNA Cleavage by a DNA Enzyme with Extended Chemical Functionality | None | 10.1021/ja993688s | RNA cleavage |