DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Zn2+
RNA phosphodiester N 40
 Buffer conditions
1 MM ZnCl2, 50 mM HEPES pH 7.0, 500 mM NaCl
 Catalytic region of the DNAzyme
TAGTTCTACCAGCGGTTCGAAATAGTGAAGTGTCCGTGA
Notes
Similar to 8-17.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2000 J Li Y Lu In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme. 10606646 10.1093/nar/28.2.481 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra