Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Zn2+ |
RNA phosphodiester | N 40 |
Buffer conditions |
---|
1 MM ZnCl2, 50 mM HEPES pH 7.0, 500 mM NaCl |
Catalytic region of the DNAzyme |
---|
TTTTGTCAGCGACTCGAAATAGTGTGTTGAAGCAGCTCTA |
Notes |
---|
Similar to 8-17. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2000 | J Li | Y Lu | In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme. | 10606646 | 10.1093/nar/28.2.481 | RNA cleavage |