Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: ACTCACTATrAGGAAGAGATG |
specific cleavage at desired position |
Zn2+ |
RNA phosphodiester | N * |
Buffer conditions |
---|
ZnCl2, 50 mM HEPES pH 7.0 |
kcat/ kobs |
---|
kmax = 1.35 min-1 |
Catalytic region of the DNAzyme |
---|
CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT |
Notes |
---|
Trans-cleaving format derived from class I reselection. Similar to 8-17. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2000 | J Li | Y Lu | In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme. | 10606646 | 10.1093/nar/28.2.481 | RNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2000 | J Li | Y Lu | A Highly Sensitive and Selective Catalytic DNA Biosensor for Lead Ions | None | 10.1021/ja0021316 |
RNA cleavage |