DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA*

Group 2 - vicinal phosphate

S: ACCTCACTATrAGGAAGATGGCGAC
specific cleavage at desired position Ni2+
PS-RNA linkage N *
 Buffer conditions
50 mM MOPS pH 8.0, 100 μM Ni2+
 Yield (%) kcat/ kobs
60 kobs = 0.63 h-1
 Catalytic region of the DNAzyme
GTCGCCACTCAAGAAGAGGACCAGATAGTGAGGT
Notes
A glycyl–histidine-functionalized tertiary amine moiety was inserted at the cleavage junction. Designed based on Ni03b and Ni03d.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2020 W Ren J Liu Selection of a metal ligand modified DNAzyme for detecting Ni. 32510338 10.1016/j.bios.2020.112285 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra