| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA* Group 2 - vicinal phosphate |
S: ACCTCACTATrAGGAAGATGGCGAC |
specific cleavage at desired position |
Ni2+ |
PS-RNA linkage | N * |
|---|
| Catalytic region of the DNAzyme |
|---|
| GTCGCCAAGCTCAAGAAGAGGACCAGGTAGTGAGGT |
| Notes |
|---|
| A glycyl–histidine-functionalized tertiary amine moiety was inserted at the cleavage junction. Truncated version of Ni03a. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2020 | W Ren | J Liu | Selection of a metal ligand modified DNAzyme for detecting Ni. | 32510338 | 10.1016/j.bios.2020.112285 | RNA cleavage |