Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rA* Group 2 - vicinal phosphate |
S: ACCTCACTATrAGGAAGATGGCGAC |
specific cleavage at desired position |
Ni2+ |
PS-RNA linkage | N * |
Buffer conditions |
---|
25 mM NaCl, 50 mM MOPS pH 7.5, Ni2+ |
Catalytic region of the DNAzyme |
---|
GTCGCCAAACTCAAGAAGAGGACCAGGTAGTGAGGT |
Notes |
---|
A glycyl–histidine-functionalized tertiary amine moiety was inserted at the cleavage junction. Truncated version of Ni03. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2020 | W Ren | J Liu | Selection of a metal ligand modified DNAzyme for detecting Ni. | 32510338 | 10.1016/j.bios.2020.112285 | RNA cleavage |