DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA*

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Cd2+
PS-RNA linkage N 50
 Buffer conditions
50 mM MES pH 6.0, 25 mM NaCl, Cd2+
 Catalytic region of the DNAzyme
CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAGTCAGAATACGGACAAAGAGTGGCAGACAGAAACCTTCGATAGCTCAAATAGTGACG
Notes
Phosphorothioate modification introduced at the cleavage site. This in vitro selection strategy prevented the isolation of Ce13-like DNAzymes. This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 28 in the reported sequence. Belongs to the BN-Cd16 family.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2015 P-J J Huang J Liu Rational evolution of Cd2+-specific DNAzymes with phosphorothioate modified cleavage junction and Cd2+ sensing. 25990730 10.1093/nar/gkv519 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra