| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA* Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Cd2+ |
PS-RNA linkage | N 50 |
|---|
| Buffer conditions |
|---|
| 50 mM MES pH 6.0, 25 mM NaCl, Cd2+ |
| Catalytic region of the DNAzyme |
|---|
| CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCATTCGATAGTTGAAATAGGTACAAGTATCACGGTGATATTGTATCATGTTAGTGTCG |
| Notes |
|---|
| Phosphorothioate modification introduced at the cleavage site. This in vitro selection strategy prevented the isolation of Ce13-like DNAzymes. This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 28 in the reported sequence. Belongs to the BN-Cd16 family. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2015 | P-J J Huang | J Liu | Rational evolution of Cd2+-specific DNAzymes with phosphorothioate modified cleavage junction and Cd2+ sensing. | 25990730 | 10.1093/nar/gkv519 | RNA cleavage |