| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA* Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Cu2+ |
PS-RNA linkage | N 50 |
|---|
| Buffer conditions |
|---|
| 50 mM MES pH 6.0, 25 mM NaCl, Cu2+ |
| Catalytic region of the DNAzyme |
|---|
| CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTATACGAACCTTACACGATACTTATTTGTAAAACAAACATTCAAGAATAGTTAGTGACGGTAAGCTTGGCAC |
| Notes |
|---|
| Phosphorothioate modification introduced at the cleavage site. This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 28 in the reported sequence. Truncated to generate a trans-cleaving form. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2016 | P-J J Huang | J Liu | An Ultrasensitive Light-up Cu(2+) Biosensor Using a New DNAzyme Cleaving a Phosphorothioate-Modified Substrate. | 26857405 | 10.1021/acs.analchem.5b04904 | RNA cleavage |