DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA*

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Cu2+
PS-RNA linkage N 50
 Buffer conditions
50 mM MES pH 6.0, 25 mM NaCl, Cu2+
 Catalytic region of the DNAzyme
CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAAACGAGATCTCAGAGCAACCCGGTATGGATCCAATCTTATTTTTTAGGCTAGTGACGGTAAGCTTGGCAC
Notes
Phosphorothioate modification introduced at the cleavage site. This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 28 in the reported sequence.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 P-J J Huang J Liu An Ultrasensitive Light-up Cu(2+) Biosensor Using a New DNAzyme Cleaving a Phosphorothioate-Modified Substrate. 26857405 10.1021/acs.analchem.5b04904 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra