| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: GTCACGAGTCACTATrAGGAAGATGGCGAAA |
specific cleavage at desired position |
Na+ M2+-independent |
RNA phosphodiester | N 50 |
|---|
| Buffer conditions |
|---|
| 50 mM MES pH 6.0, 130 mM NaCl, 60% (V/V) alcohol |
| kcat/ kobs |
|---|
| kobs = 2 h-1 |
| Catalytic region of the DNAzyme |
|---|
| TTTCGCCATCTTTTCTCACACCGTACTCGGTAAGGTTGTTAGTGACTCGTGAC |
| Notes |
|---|
| Discovered accidentally. The in vitro selection was intended for the isolation of hemin-dependent RNA-cleaving DNAzymes. Of the 34 isolated sequences from the in vitro selection, 30 were identical. One of them was engineered into the trans-cleaving DNAzyme EtNa. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2015 | W Zhou | J Liu | A New Na+‐Dependent RNA‐Cleaving DNAzyme with over 1000‐fold Rate Acceleration by Ethanol | None | 10.1002/cbic.201500603 | RNA cleavage |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2017 | W Zhou | J Liu | Two Completely Different Mechanisms for Highly Specific Na+ Recognition by DNAzymes | None | 10.1002/cbic.201700184 |
RNA cleavage |
| 2017 | W Zhou | J Liu | An Exceptionally Selective DNA Cooperatively Binding Two Ca Ions. | 28087991 | 10.1002/cbic.201600708 |
RNA cleavage |
| 2018 | T Yu | J Liu | An RNA-Cleaving Catalytic DNA Accelerated by Freezing. | 29537685 | 10.1002/cbic.201800049 |
RNA cleavage |