Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Dy3+ |
RNA phosphodiester | N 50 |
---|
Buffer conditions |
---|
50 mM MES pH 6.0, 25 mM NaCl, 10 µM Dy3+ |
Catalytic region of the DNAzyme |
---|
CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACAAAATGGAGCCATAGGTCAAAGGTGGGTGCTGGTCGTATCATATCGACTAGTTATAGTGACGGTAAGCT |
Notes |
---|
This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 28 in the reported sequence. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | P-J J Huang | J Liu | In Vitro Selection of a DNAzyme Cooperatively Binding Two Lanthanide Ions for RNA Cleavage. | 27054549 | 10.1021/acs.biochem.6b00132 | RNA cleavage |