DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Dy3+
RNA phosphodiester N 50
 Buffer conditions
50 mM MES pH 6.0, 25 mM NaCl, 10 µM Dy3+
 Catalytic region of the DNAzyme
CTGCAGAATTCTAATACGATCACTATAGGAAGATGGCGAAACATCTTTACAAGCATACGGTTATAGGGGTCGGACTTACGGATTTAAGATACAAAGCTATGACGGTAAGCT
Notes
This is the cis-cleaving version of the DNAzyme. Sequences have been annotated as reported. The cleavage site rA is in position 28 in the reported sequence.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 P-J J Huang J Liu In Vitro Selection of a DNAzyme Cooperatively Binding Two Lanthanide Ions for RNA Cleavage. 27054549 10.1021/acs.biochem.6b00132 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra