Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Er3+ |
RNA phosphodiester | N 35 |
---|
Buffer conditions |
---|
50 mM MES pH 6.0, 25 mM NaCl, 10 µM Er3+ |
Catalytic region of the DNAzyme |
---|
CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCGAGATGATTTATATAACGAGTAAAGGACCGATTGTAGTCGGTAAGCTTG |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2015 | P-J J Huang | J Liu | A new heavy lanthanide-dependent DNAzyme displaying strong metal cooperativity and unrescuable phosphorothioate effect. | 25488814 | 10.1093/nar/gku1296 | RNA cleavage |