Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: ACGAGTCACTATrAGGAAGATGGCGAAA |
specific cleavage at desired position |
Ce3+ Cr3+ |
RNA phosphodiester | N 50 |
Buffer conditions |
---|
50 mM MES pH 6.0, 25 mM NaCl, 10 μM Ce3+ |
kcat/ kobs |
---|
kobs = 0.25 min-1 |
Catalytic region of the DNAzyme |
---|
TTTCGCCATAGGTCAAAGGTGGGTGCGAGTTTTTACTCGTTATAGTGACTCGT |
Notes |
---|
Truncated version of Ce13 |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2014 | P-J J Huang | J Liu | Ultrasensitive DNAzyme beacon for lanthanides and metal speciation. | 24383540 | 10.1021/ac403762s | RNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2017 | W Zhou | J Liu | Two Completely Different Mechanisms for Highly Specific Na+ Recognition by DNAzymes | None | 10.1002/cbic.201700184 |
RNA cleavage |
2015 | S-F Torabi | Y Lu | Identification of the Same Na(+)-Specific DNAzyme Motif from Two In Vitro Selections Under Different Conditions. | 26577294 | 10.1007/s00239-015-9715-7 |
RNA cleavage |
2016 | W Zhou | J Liu | In Vitro Selection of Chromium-Dependent DNAzymes for Sensing Chromium(III) and Chromium(VI). | 27249536 | 10.1002/chem.201601426 |
RNA cleavage |
2019 | P-J J Huang | J Liu | Instantaneous Iodine-Assisted DNAzyme Cleavage of Phosphorothioate RNA. | 30272443 | 10.1021/acs.biochem.8b00900 |
RNA cleavage |
2015 | M Vazin | J Liu | Biochemical Characterization of a Lanthanide-Dependent DNAzyme with Normal and Phosphorothioate-Modified Substrates. | 26356231 | 10.1021/acs.biochem.5b00691 |
RNA cleavage |