Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: ACGAGTCACTATrAGGAAGATGGCGAAA |
specific cleavage at desired position |
Ce3+ |
RNA phosphodiester | N 50 |
---|
Buffer conditions |
---|
50 mM MES pH 6.0, 25 mM NaCl |
Catalytic region of the DNAzyme |
---|
TTTCGCCATAGGTCAAAGGTGGGTGCGGGTCGTTTTTCGACTAAGTTATAGTGACTCGT |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2014 | P-J J Huang | J Liu | Ultrasensitive DNAzyme beacon for lanthanides and metal speciation. | 24383540 | 10.1021/ac403762s | RNA cleavage |