| Reaction | Reacting groups | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
inactive |
Gd3+ |
RNA phosphodiester | N 50 |
|---|
| Buffer conditions |
|---|
| 10 µM Gd3+, 50 mM MES pH 6.0, 25 mM NaCl |
| Catalytic region of the DNAzyme |
|---|
| TTTCGCCATCTTGACGCATAGCACGTGTTAGTGACTCGT |
| Notes |
|---|
| Truncated version of Gd2. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2016 | P-J J Huang | J Liu | Distinction of Individual Lanthanide Ions with a DNAzyme Beacon Array | None | 10.1021/acssensors.6b00239 | RNA cleavage |