Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Gd3+ |
RNA phosphodiester | N 50 |
Buffer conditions |
---|
100 µM Gd3+ and same buffer as Ce13d |
Catalytic region of the DNAzyme |
---|
TCGCCATCTTGACGCATATCGGCGACCAATAAAATCAGAGGTAAAGACGATAGCACGTGTTAGTGACTCGT |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | P-J J Huang | J Liu | Distinction of Individual Lanthanide Ions with a DNAzyme Beacon Array | None | 10.1021/acssensors.6b00239 | RNA cleavage |