Reaction | Reacting groups | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
specific cleavage at desired position |
Gd3+ |
RNA phosphodiester | N 50 |
---|
Buffer conditions |
---|
10 µM Gd3+, 50 mM MES pH 6.0, 25 mM NaCl |
kcat/ kobs |
---|
kobs = 0.012 min-1 |
Catalytic region of the DNAzyme |
---|
TCGCCATCTTGACGCATATCGTTTTCGATAGCACGTGTTAGTGACTCGT |
Notes |
---|
Truncated version of Gd2. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | P-J J Huang | J Liu | Distinction of Individual Lanthanide Ions with a DNAzyme Beacon Array | None | 10.1021/acssensors.6b00239 | RNA cleavage |