Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis |
inactive |
Ag+ |
RNA phosphodiester | N * |
---|
Buffer conditions |
---|
50 mM MES pH 6.0, 50 mM NaNO3, 10 µM Ag+ |
Catalytic region of the DNAzyme |
---|
TTTCGCCATCTTTGAGGTGATTTCCTTTTGGAAATGAAATAACGTATAGTGACTCGTGAC |
Notes |
---|
Reselected from Ag10c. Refer to the original reference for details about the library composition. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2018 | L Gu | J Liu | Reselection Yielding a Smaller and More Active Silver-Specific DNAzyme. | 31458180 | 10.1021/acsomega.8b02039 | RNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | R Saran | J Liu | A Silver DNAzyme. | 26977895 | 10.1021/acs.analchem.6b00327 |
RNA cleavage |