DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Ag+
RNA phosphodiester N *
 Buffer conditions
50 mM MES pH 6.0, 50 mM NaNO3, 10 µM Ag+
 Catalytic region of the DNAzyme
TTTCGCCATCTTTGGGTGATTTCCTTTTGGAAACAGGGCAGCGTATAGTGACTCGTGAC
Notes
Reselected from Ag10c. Refer to the original reference for details about the library composition.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2018 L Gu J Liu Reselection Yielding a Smaller and More Active Silver-Specific DNAzyme. 31458180 10.1021/acsomega.8b02039 RNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 R Saran J Liu A Silver DNAzyme. 26977895 10.1021/acs.analchem.6b00327 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra