| Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | DNA phosphorylation |
Group 1 - ATP Group 2 - 5'-OH of substrate DNA |
S: GGAAAGATGCGAC |
Phosphorylated DNA at its 5'-end |
Ca2+ K+ |
N 70 |
|---|
| Buffer conditions |
|---|
| 100 mM Hepes pH 7.0, 800 mM NaCl, 200 mM KCl, 20 mM MgCl2, 10 mM CaCl2, 2 mM MnCl2, 100 μM CuCl2 |
| kcat/ kobs |
|---|
| kcat = 1.7 x 10-4 min-1 |
| Catalytic region of the DNAzyme |
|---|
| GGCGGGGTGGCTGATGGGTGAGGAGTGATAGGGCAGTGGGCGAGGAGGCGGGTTGAGGTGGCGTAGTGCC |
| Notes |
|---|
| Self-phosphorylating. The 5' domain of the self-phosphorylating DNAzyme is annotated as substrate and it would be directly upstream from the catalytic region. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 1999 | Y Li | R R Breaker | Phosphorylating DNA with DNA. | 10077582 | 10.1073/pnas.96.6.2746 | DNA phosphorylation |