DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
DNA phosphorylation Group 1 - ATP

Group 2 - 5'-OH of substrate DNA

S: GGAAAGATGGAC
Phosphorylated DNA at its 5'-end Ca2+
N 70
 Buffer conditions
100 mM Hepes pH 7.0, 800 mM NaCl, 200 mM KCl, 20 mM MgCl2, 10 mM CaCl2, 2 mM MnCl2, 100 μM CuCl2
 kcat/ kobs
kcat = 5.5 x 10-3 min-1
 Catalytic region of the DNAzyme
GTCGGGGTGGCTGTTGGGTGAGGAGTGATAGGGCTATGGGCGAGGAGACGGGTTGAGGTGGCAGAGAGCC
Notes
Self-phosphorylating. The 5' domain of the self-phosphorylating DNAzyme is annotated as substrate and it would be directly upstream from the catalytic region. Reselected from NTP-A2.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1999 Y Li R R Breaker Phosphorylating DNA with DNA. 10077582 10.1073/pnas.96.6.2746 DNA phosphorylation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra