Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | DNA phosphorylation |
Group 1 - dNTP Group 2 - 5'-OH of substrate DNA |
S: GGAAGAGATGGCGAC |
Phosphorylated DNA at its 5'-end |
Mn2+ Ca2+ |
N 70 |
---|
Buffer conditions |
---|
100 mM Hepes pH 7.0, 800 mM NaCl, 200 mM KCl, 20 mM MgCl2, 10 mM CaCl2, 2 mM MnCl2, 100 μM CuCl2 |
Catalytic region of the DNAzyme |
---|
AGCCATAAGGGGGGAGAACCTCTGATCCTGGTTCAAGGAGAACGGGCGGCCGGGGGGATGTCTCGTGTTG |
Notes |
---|
Self-phosphorylating. The 5' domain of the self-phosphorylating DNAzyme is annotated as substrate and it would be directly upstream from the catalytic region. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
1999 | Y Li | R R Breaker | Phosphorylating DNA with DNA. | 10077582 | 10.1073/pnas.96.6.2746 | DNA phosphorylation |