DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 3 '- OH

Group 2 - 5'-adenylated RNA

L: GGCGAACUCUUCGA
R: GAGCUGAUCCUGAGAA
native RNA Mn2+
3',5' N 40
 Buffer conditions
50 mM HEPES pH 7.5, 2 mM KCl, 150 mM NaCl, MgCl2, 20 mM MnCl2
 Yield (%) kcat/ kobs
70 kobs = 0.0093 min-1
 Catalytic region of the DNAzyme
ACCGTCACAAAAGACTGTAGTTAATACCACTGCAGGTCGT

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2020 C P M Scheitl C Höbartner New Deoxyribozymes for the Native Ligation of RNA. 32796587 10.3390/molecules25163650 RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra