Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
Zn2+ |
RNA phosphodiester | N 40 |
---|
Buffer conditions |
---|
500 mM NaCl, 50 mM HEPES pH 7.0, ZnCl2 0.1 µM |
Catalytic region of the DNAzyme |
---|
CATCTCGATCATACACAACCCTTAGGTTGAACCACATTTCCAGCTTGTGACG |
Notes |
---|
The annotated sequence contains 3' and 5' conserved regions in addition to the N<sub>40</sub> region. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2005 | K E Nelson | Y Lu | In vitro selection of high temperature Zn(2+)-dependent DNAzymes. | 16096680 | 10.1007/s00239-004-0374-3 | RNA cleavage |