| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rC Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
M2+-independent |
RNA phosphodiester | N 20 |
|---|
| Buffer conditions |
|---|
| 50 mM sodium cacodylate pH 7.4, 200 mM NaCl, 1 mM EDTA |
| Catalytic region of the DNAzyme |
|---|
| ACCAACATTCCCAGCGGGAGTGTCGCC |
| Notes |
|---|
| The sequence includes the random region and 7 nucleotides of the guide sequence at the 5'-end. The DNA pool contained modified nucleoside triphosphates dA<sup>im</sup>TP, dC<sup>aa</sup>TP, and dU<sup>ga</sup>TP. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2009 | M Hollenstein | D M Perrin | A self-cleaving DNA enzyme modified with amines, guanidines and imidazoles operates independently of divalent metal cations (M2+). | 19153138 | 10.1093/nar/gkn1070 | RNA cleavage |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2013 | M Hollenstein | D M Perrin | Toward the combinatorial selection of chemically modified DNAzyme RNase A mimics active against all-RNA substrates. | 23485334 | 10.1021/co3001378 |
RNA cleavage |