DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rC

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position M2+-independent
RNA phosphodiester N 20
 Buffer conditions
50 mM sodium cacodylate pH 7.4, 200 mM NaCl, 1 mM EDTA
 kcat/ kobs
kobs < 10-4 min-1
 Catalytic region of the DNAzyme
ACCAAAATGCAGCACTAGTGTCTGGCATGTTG
Notes
The sequence includes the random region and 7 nucleotides of the guide sequence at the 5'-end. The DNA pool contained modified nucleoside triphosphates dA<sup>im</sup>TP, dC<sup>aa</sup>TP, and dU<sup>ga</sup>TP.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2013 M Hollenstein D M Perrin Toward the combinatorial selection of chemically modified DNAzyme RNase A mimics active against all-RNA substrates. 23485334 10.1021/co3001378 RNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2009 M Hollenstein D M Perrin A self-cleaving DNA enzyme modified with amines, guanidines and imidazoles operates independently of divalent metal cations (M2+). 19153138 10.1093/nar/gkn1070 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra