Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rC Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position |
M2+-independent |
RNA phosphodiester | N 20 |
---|
Buffer conditions |
---|
50 mM sodium cacodylate pH 7.4, 200 mM NaCl, 1 mM EDTA |
kcat/ kobs |
---|
kobs = 0.0147 min-1 |
Catalytic region of the DNAzyme |
---|
ACCAACAAGTTATAGTGGTAAGCGGTTG |
Notes |
---|
The sequence includes the random region and 7 nucleotides of the guide sequence at the 5'-end. The DNA pool contained modified nucleoside triphosphates dA<sup>im</sup>TP, dC<sup>aa</sup>TP, and dU<sup>ga</sup>TP. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2013 | M Hollenstein | D M Perrin | Toward the combinatorial selection of chemically modified DNAzyme RNase A mimics active against all-RNA substrates. | 23485334 | 10.1021/co3001378 | RNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2009 | M Hollenstein | D M Perrin | A self-cleaving DNA enzyme modified with amines, guanidines and imidazoles operates independently of divalent metal cations (M2+). | 19153138 | 10.1093/nar/gkn1070 |
RNA cleavage |