| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rU Group 2 - vicinal phosphate |
S: AAAAGUAACUAGAGAUGG |
specific cleavage at desired position |
Mg2+ |
RNA phosphodiester | N * |
|---|
| Buffer conditions |
|---|
| 1 M NaCl, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 |
| kcat/ kobs |
|---|
| kobs = 0.015 min-1 and 0.0027 min-1 towards RNA substrates with UU and UA cleavage site junctions, respectively. |
| Catalytic region of the DNAzyme |
|---|
| CATTTCTCGCTTTGCTGGATGTTACTTTT |
| Notes |
|---|
| Optimization of 10–12 catalytic core for improved activity. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2019 | Y Wang | H Yu | A Novel Small RNA-Cleaving Deoxyribozyme with a Short Binding Arm | None | 10.1038/s41598-019-44750-x | RNA cleavage |